PURIMEX determines the molecular weight of the unmodified DNA oligonucleotides on the assumption that the counterion is Na +, as follows:

MW = (nA x 312) + (328 x nG) + (288 x nC) + (303 x nT) + (23 x n-1) -63 + 2

with nA, NG, NC and nT = number of corresponding bases

Example:

The 20mer AGCTAGCTAGCTAGCTAGCT has a molecular weight of:

MW = (5 x 312) + (5 x 328) + (5 x 288) + (5 x 303) + (23 x 19) = -63 + 2 6531 [g / mol]

Go to top