Extinction coefficient of the unmodified DNA / RNA oligonucleotides

In DNA, we calculate the micromolar extinction coefficient for UV absorption at a wavelength of 260 nm under the assumption that the influence of hyperchromicity (UV-extinction by base stacking) a factor of 0.9 corresponds to (approximation) as follows :

E260 = 0.9 [(nA x 15.4) + (ng x 11.5) + (nC x 7.3) + (nT x 8.8)]

Example:

The 20mer AGCTAGCTAGCTAGCTAGCT dissolved in 1 ml and is measured in a cuvette 1 cm path length, has an absorption of:

E260 = 0.9 [(5 x 15.4) + (5 x 11.5) + (5 x 7.3) + (5 x 8.8)] = 193.5 [AU x ml / micromol x cm ]

Is at the RNA

E260 = 0.9 [(nA x 15.4) + (ng x 11.5) + (nC x 7.2) + (9.9 x nU)]

AU: absorption units

Go to top