Extinktionskoeffizient von unmodifizierten DNA/RNA-Oligonucleotiden

Bei der DNA berechnen wir den micromolaren Extinktionskoeffizienten für die UV-Absorption bei einer Wellenlänge von 260 nm unter der Annahme, daß der Einfluß der Hyperchromizität (UV-Löschung durch Basen-Stacking) einem Faktor von 0,9 entspricht (Näherung), wie folgt:

E260 = 0,9 [(nA x 15,4) + (nG x 11,5) + (nC x 7,3) + (nT x 8,8)]

Beispiel:

Das 20mer AGCTAGCTAGCTAGCTAGCT, das in 1 ml gelöst ist und vermessen wird in einer Küvette mit 1 cm Weglänge, hat eine Absorption von:

E260 = 0,9 [(5 x 15,4) + (5 x 11,5) + (5 x 7,3) + (5 x 8,8)] = 193,5 [ AU x ml/µmol x cm]

 

Bei der RNA ist

E260 = 0,9 [(nA x 15,4) + (nG x 11,5) + (nC x 7,2) + (nU x 9,9)]

AU: Absorption units

Zum Seitenanfang