PURIMEX bestimmt das Molekulargewicht von unmodifizierten DNA-Oligonucleotiden unter der Annahme, daß das Gegenion Na+ ist, wie folgt:

MW = (312 x nA) + (328 x nG) + (288 x nC) + (303 x nT) + (23 x n-1)-63+2

mit nA, nG, nC und nT = Anzahl der entsprechenden Basen

 

Beispiel:

Das 20mer AGCTAGCTAGCTAGCTAGCT hat ein Molekulargewicht von:

MW = (5 x 312) + (5 x 328) + (5 x 288) + (5 x 303) + (23 x 19) -63 + 2= 6531 [g/mol]

Zum Seitenanfang